What do mutations do to a gene?
Here's a DNA sequence for a very short gene:
name
ATGAAGCTCTGGATAGCCGATAACCCCCCTCTCAGACAGTAA
This would give the following RNA
AUGAAGCUCUGGAUAGCCGAUAACCCCCCUCUCAGACAGUAA
2nd position
U
C
A
G
The nearly-universal genetic
code is shown on the right.
This is how cells of almost
all organisms translate the
RNA code. The table shows
which amino acid is specified
by each 3-letter "word" in
the RNA.
If you translate this RNA,
what protein sequence do
you get?
 
Here's a hint about how to
do this most easily:
U
3-letter "word"
corresponding amino acid
C
A
G
Now, here are some RNAs from mutant versions of this gene. The mutations are
indicated with arrows. Translate each of these gene versions...what happens?
Effect on protein:
insert 1 base
see the back for some thoughts about what amino acid changes can do
Previous
Back to Scenarios
Next