|
What do mutations do to a gene? |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Here's a DNA sequence for a very short gene: |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
name |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATGAAGCTCTGGATAGCCGATAACCCCCCTCTCAGACAGTAA |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
This would give the following RNA |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
AUGAAGCUCUGGAUAGCCGAUAACCCCCCUCUCAGACAGUAA |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
2nd position |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
U |
C |
A |
G |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
The nearly-universal genetic
code is shown on the right. This is how cells of almost all organisms translate the RNA code. The table shows which amino acid is specified by each 3-letter "word" in the RNA.
If you translate this RNA,
what protein sequence do you get?
Here's a hint about how to do this most easily: |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
U |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
3-letter "word" |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
corresponding amino acid |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
C |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
A |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
G |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Now, here are some RNAs from mutant versions of this gene. The mutations are indicated with arrows. Translate each of these gene versions...what happens? |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Effect on protein: |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
insert 1 base |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
see the back for some thoughts about what amino acid changes can do |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||